SGN Marker solcap_snp_sl_6371

SGN-M25412

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66045)
Chromosome
7
Position
55.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61743)
Chromosome
7
Position
58.65 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CGTTATGTAATGAGATGTGTTTTCGGTGACCCCGAAAAGGCTCCCCCTCC
  
3' flanking region
CTTGAGAGGCTTAATCCTGAAGAGGCTGTTTCTTTTATCTGGAGAGGAGA
SNP nucleotide
AT
SNPdb format
CGTTATGTAATGAGATGTGTTTTCGGTGACCCCGAAAAGGCTCCCCCTCC[A/T]
CTTGAGAGGCTTAATCCTGAAGAGGCTGTTTCTTTTATCTGGAGAGGAGA
  
Genomic location of solcap_snp_sl_6371  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25412 marker 25412
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)