Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker solcap_snp_sl_63713

SGN-M25413

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74080)
Chromosome
9
Position
72.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61744)
Chromosome
9
Position
67.18 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GACAAGGTTCGTGACAGTTTTGAATTTGTCGTTGATGCCTTTGGGATTGG
  
3' flanking region
AATGTTGAATTCGATCGCATTCTCCGTGTCTATCCGGCTGTTTTGGTCTA
SNP nucleotide
TC
SNPdb format
GACAAGGTTCGTGACAGTTTTGAATTTGTCGTTGATGCCTTTGGGATTGG[T/C]
AATGTTGAATTCGATCGCATTCTCCGTGTCTATCCGGCTGTTTTGGTCTA
  
Genomic location of solcap_snp_sl_63713  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25413 marker 25413
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)