SGN Marker solcap_snp_sl_64635

SGN-M25466

Synonyms  
CL016995-0330
CL016995-0330_solcap_snp_sl_64635
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61797)
Chromosome
8
Position
57.15 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGGAAATTTGTGGAATCCGTTGCTGATTTTCAGTGGTGATACGCCTGTTC
  
3' flanking region
TATGCCTGGGGATGGTGGAGTTTTGGAGTTTCTTAATGAGGCACTTGGAT
SNP nucleotide
AG
SNPdb format
AGGAAATTTGTGGAATCCGTTGCTGATTTTCAGTGGTGATACGCCTGTTC[A/G]
TATGCCTGGGGATGGTGGAGTTTTGGAGTTTCTTAATGAGGCACTTGGAT
  
Genomic location of solcap_snp_sl_64635  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25466 marker 25466
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)