Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_64706

SGN-M25472

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74116)
Chromosome
8
Position
54.69 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69735)
Chromosome
8
Position
44.02 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66064)
Chromosome
8
Position
67.54 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61803)
Chromosome
8
Position
57.57 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATGATAGGTTACCGTTTGAATTGGGGCAGAGTAAGAGGAGGGAACCAGGG
  
3' flanking region
GAACAGAGAGTGGGTCGAAGCGTTTGAAAGTCAGAGGTCCTTCAGTTTTA
SNP nucleotide
AG
SNPdb format
ATGATAGGTTACCGTTTGAATTGGGGCAGAGTAAGAGGAGGGAACCAGGG[A/G]
GAACAGAGAGTGGGTCGAAGCGTTTGAAAGTCAGAGGTCCTTCAGTTTTA
  
Genomic location of solcap_snp_sl_64706  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25472 marker 25472
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)