Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_65244

SGN-M25498

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74132)
Chromosome
8
Position
63.76 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69745)
Chromosome
8
Position
59.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66074)
Chromosome
8
Position
89.97 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61829)
Chromosome
8
Position
60.28 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCAAAGCGTTATGACAACATCATACATCTAAAACTAGTTTGGATTTACTG
  
3' flanking region
ACAGACCTCAAACAAACATCAAATAGGAGGTGAGAAGGATCAATATGAAC
SNP nucleotide
AC
SNPdb format
CCAAAGCGTTATGACAACATCATACATCTAAAACTAGTTTGGATTTACTG[A/C]
ACAGACCTCAAACAAACATCAAATAGGAGGTGAGAAGGATCAATATGAAC
  
Genomic location of solcap_snp_sl_65244  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25498 marker 25498
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)