SGN Marker solcap_snp_sl_65692

SGN-M25521

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74145)
Chromosome
6
Position
2.75 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61852)
Chromosome
6
Position
1.36 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTAATAAGGTCTGCGTACGTACATTCTATCCTCTTCAGATTTTATTCGT
  
3' flanking region
ATATTTCACTCTATATGTAGTCGTTGGTTGATTTTTGATTTGGATATAGA
SNP nucleotide
AG
SNPdb format
AGTAATAAGGTCTGCGTACGTACATTCTATCCTCTTCAGATTTTATTCGT[A/G]
ATATTTCACTCTATATGTAGTCGTTGGTTGATTTTTGATTTGGATATAGA
  
Genomic location of solcap_snp_sl_65692  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25521 marker 25521
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)