SGN Marker solcap_snp_sl_65977

SGN-M25540

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74159)
Chromosome
2
Position
32.74 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61871)
Chromosome
2
Position
35.99 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCCTGAAGCTTGTTTGTGCTCGATGCTTGTATCATGTAAAATATCCTTT
  
3' flanking region
AGAATTTCTGTAAATTAACCTAGTCTTTTCATGTAAAACATTCGGGCGCT
SNP nucleotide
CG
SNPdb format
TTCCTGAAGCTTGTTTGTGCTCGATGCTTGTATCATGTAAAATATCCTTT[C/G]
AGAATTTCTGTAAATTAACCTAGTCTTTTCATGTAAAACATTCGGGCGCT
  
Genomic location of solcap_snp_sl_65977  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25540 marker 25540
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)