SGN Marker solcap_snp_sl_66569

SGN-M25563

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74172)
Chromosome
11
Position
1.92 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69776)
Chromosome
11
Position
3.17 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66103)
Chromosome
11
Position
5.55 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61894)
Chromosome
11
Position
0.76 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATGTTTCAACTTATAATGTGCTACTTCATGGGCTTGGTGAGAAGGGTAAA
  
3' flanking region
TAGATGAAGCCTTGTTGCTCTGGGATGAATGTCGAAGCAAGGGACTTGTC
SNP nucleotide
AG
SNPdb format
ATGTTTCAACTTATAATGTGCTACTTCATGGGCTTGGTGAGAAGGGTAAA[A/G]
TAGATGAAGCCTTGTTGCTCTGGGATGAATGTCGAAGCAAGGGACTTGTC
  
Genomic location of solcap_snp_sl_66569  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25563 marker 25563
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)