Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker solcap_snp_sl_66845

SGN-M25574

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61905)
Chromosome
2
Position
47.97 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGACACTACGAATGCATCCACCATTACCGTTGTTACTACCAAGAGAAGCT
  
3' flanking region
TAGAAAAATGTGAAATTGGTGGCTATGACATACCTGCAAAAACCAAAGTC
SNP nucleotide
AG
SNPdb format
AGACACTACGAATGCATCCACCATTACCGTTGTTACTACCAAGAGAAGCT[A/G]
TAGAAAAATGTGAAATTGGTGGCTATGACATACCTGCAAAAACCAAAGTC
  
Genomic location of solcap_snp_sl_66845  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25574 marker 25574
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)