Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker solcap_snp_sl_66951

SGN-M25578

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74182)
Chromosome
2
Position
73.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61909)
Chromosome
2
Position
47.37 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTTTCGTTTGTATTCTCACAATTCATCATCACCGCAAAGTGTTGACCCT
  
3' flanking region
AATCCAACTCTTCTGGTGGACGATAAGCACCGGACCCCTTCCCCTCACGG
SNP nucleotide
AT
SNPdb format
TCTTTCGTTTGTATTCTCACAATTCATCATCACCGCAAAGTGTTGACCCT[A/T]
AATCCAACTCTTCTGGTGGACGATAAGCACCGGACCCCTTCCCCTCACGG
  
Genomic location of solcap_snp_sl_66951  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25578 marker 25578
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)