SGN Marker solcap_snp_sl_67010

SGN-M25584

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74187)
Chromosome
2
Position
72.74 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69787)
Chromosome
2
Position
94.74 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66114)
Chromosome
2
Position
134.78 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61915)
Chromosome
2
Position
47.10 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTAGCTGCTACTGCTGCAAGGTCACTGGCTATTGGAAAGTGTGATGTGGC
  
3' flanking region
TTGATAGTTGGCGCAAGGCTTAATTGGCTTTTGCATTTCGGAGAGCCACC
SNP nucleotide
CG
SNPdb format
CTAGCTGCTACTGCTGCAAGGTCACTGGCTATTGGAAAGTGTGATGTGGC[C/G]
TTGATAGTTGGCGCAAGGCTTAATTGGCTTTTGCATTTCGGAGAGCCACC
  
Genomic location of solcap_snp_sl_67010  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25584 marker 25584
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)