SGN Marker solcap_snp_sl_67032

SGN-M25586

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74188)
Chromosome
2
Position
71.91 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69788)
Chromosome
2
Position
93.80 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66115)
Chromosome
2
Position
134.10 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61917)
Chromosome
2
Position
46.95 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTACTTGTTTGGATATCAATCTTCCTTGCCCCACCACCATCCTCACTTT
  
3' flanking region
ACCCACAAATCCCACTTTCTTTGGCCTAATTAACAATTTTTTCAATAAAT
SNP nucleotide
AC
SNPdb format
ATTACTTGTTTGGATATCAATCTTCCTTGCCCCACCACCATCCTCACTTT[A/C]
ACCCACAAATCCCACTTTCTTTGGCCTAATTAACAATTTTTTCAATAAAT
  
Genomic location of solcap_snp_sl_67032  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25586 marker 25586
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)