SGN Marker solcap_snp_sl_67034

SGN-M25587

Synonyms  
ABA1_Promoter_SNP2
ABA1_Promoter_SNP2_solcap_snp_sl_67034
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70079)
Chromosome
2
Position
71.91 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66394)
Chromosome
2
Position
93.80 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 62893)
Chromosome
2
Position
134.10 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61918)
Chromosome
2
Position
46.95 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATGCATTGGCTGCTTTAGAAGCAATTGATTTGGATGTTGCTGAAGACAT
  
3' flanking region
ATGAATGCTGGCTGCATCACTGGTCAAAGGATTAATGGCTTGGTTGATGG
SNP nucleotide
TC
SNPdb format
AATGCATTGGCTGCTTTAGAAGCAATTGATTTGGATGTTGCTGAAGACAT[T/C]
ATGAATGCTGGCTGCATCACTGGTCAAAGGATTAATGGCTTGGTTGATGG
  
Genomic location of solcap_snp_sl_67034  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25587 marker 25587
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)