SGN Marker solcap_snp_sl_67036

SGN-M25588

Synonyms  
ABA1_2029
ABA1_2029_solcap_snp_sl_67036
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70077)
Chromosome
2
Position
71.91 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66392)
Chromosome
2
Position
93.17 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 62891)
Chromosome
2
Position
134.10 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61919)
Chromosome
2
Position
46.95 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAAATTTCCACTAAAAACTTCTGAAAGGAAGGAAGAGCGCGAAGCAGTGG
  
3' flanking region
GGCAGCGTAAAGCTTGACCTGATATAAACAGGAAATTGTACAGCATTTTA
SNP nucleotide
AG
SNPdb format
GAAATTTCCACTAAAAACTTCTGAAAGGAAGGAAGAGCGCGAAGCAGTGG[A/G]
GGCAGCGTAAAGCTTGACCTGATATAAACAGGAAATTGTACAGCATTTTA
  
Genomic location of solcap_snp_sl_67036  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25588 marker 25588
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)