SGN Marker solcap_snp_sl_67038

SGN-M25589

Synonyms  
ABA1_2206
ABA1_2206_solcap_snp_sl_67038
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61920)
Chromosome
2
Position
46.95 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAGACACCATGAAAGAAAATACAGAGATTCTCCTAAAGAAATCTGGAGAA
  
3' flanking region
GTCATGGACATTGTCTCTTATTCTACCATTGCTAAAAATATATTACTTCT
SNP nucleotide
AT
SNPdb format
AAGACACCATGAAAGAAAATACAGAGATTCTCCTAAAGAAATCTGGAGAA[A/T]
GTCATGGACATTGTCTCTTATTCTACCATTGCTAAAAATATATTACTTCT
  
Genomic location of solcap_snp_sl_67038  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25589 marker 25589
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)