SGN Marker solcap_snp_sl_67052

SGN-M25590

Synonyms  
CL017715-0287
CL017715-0287_solcap_snp_sl_67052
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61921)
Chromosome
2
Position
46.86 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAGAACCAGCAATATTTACGTTATTCATATCCGCCTCGTTGATACCCATT
  
3' flanking region
CGGAGGATGAGGGTGTGTGCTTCCAATCAGGCTGCTTTCCAGAAGGTAAA
SNP nucleotide
AG
SNPdb format
GAGAACCAGCAATATTTACGTTATTCATATCCGCCTCGTTGATACCCATT[A/G]
CGGAGGATGAGGGTGTGTGCTTCCAATCAGGCTGCTTTCCAGAAGGTAAA
  
Genomic location of solcap_snp_sl_67052  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25590 marker 25590
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)