SGN Marker solcap_snp_sl_6718

SGN-M25596

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74190)
Chromosome
1
Position
115.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69790)
Chromosome
1
Position
102.70 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61927)
Chromosome
1
Position
86.48 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAAGGAACTGGTGTTGGTTGTTTTTAGTAGATCTCTTACTTGTTCAAATG
  
3' flanking region
AGGCATGAGGAAGAGGAGTCCAGTTTGAAAGTAGTCAATTTGAAGCTCAA
SNP nucleotide
TC
SNPdb format
TAAGGAACTGGTGTTGGTTGTTTTTAGTAGATCTCTTACTTGTTCAAATG[T/C]
AGGCATGAGGAAGAGGAGTCCAGTTTGAAAGTAGTCAATTTGAAGCTCAA
  
Genomic location of solcap_snp_sl_6718  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25596 marker 25596
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)