SGN Marker TG292

SGN-M256

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG292 image not available
Forward sequence
GTCAATTCAGCCTATGCACCATGAACCATCAGAATTAGCCAAAAAGTGACTTTTCCCCCCTTTATTTAGAAGGTAACATTTTTATGTATT
GACTAAATCAGTACATAGGTTGGACACAAAACCATATTTACAATCATAGGAAAAAGCCAAGAAACCTGATGCAAAATCCTAACCAGAGCC
TAGGATGTCTATGATAGAATCAGTGTCTTCTCGCTATATCTGTGCGCATCTGGTGACATGTTCCCTTCTGATTATTGCAATCCTTATTGA
AACTCTTTTTTAGTTGAAATTTATGTTTACAATAGACAAGAAGTTCAAAATATCACAAAATTTTTGTTGGGCCTTATTTATGCTGAAAAA
AGTTGCAAAGCGGATTTTGTATGTTTTTATGTTGATAAATATTCAGTTTTAATTATATAGGGCTCATGACAAAGTTATATTTCATGATCT
TATGTTCCTCTGGATCTGAAGAGGAAGAATGTATTAGACGTCAGAGGGAACTTATGTTTTG
Reverse sequence
CTCCTATAGGGAGACAAGCCTGCATGCCTGCAGTGGAATATCATCAAGTACATATAGTACAAGCCAAACATACAAACTTCTACAGCTCCC
TTCACAGCTATTATTAATCTGAATCACCCAGTCTCTAACCAAAATCAAGAAACTACAAAGATGTCCATGGATATAGCGGAGAGAAGCACA
GTTTTGTTAATGCGTGAATGTCAAATCTGTAAGGGTCTAGATTTAATACAAGAATACATTATGTTCAAAAACCAACAACTTATCATGCAC
CCTAGAGGAACATTGCATAGTCCAATTACTAAGAGACACTGTTCTTTTGTTGGGCATGAAATACAGTTTTAAGCAGGCAACTACCGCCGA
ATATCCAAACACAACCAAAAATCTTATTAACTACTGTAGACTAGCAAAAACCTTTGGGGTTGTTTGGTTCAAATACTAGTCATAAATGGA
TTATAGTGCAAGGATTGTCAATGCAACGATAAATAATGAAGGGATTATTATGCATTGATGAATAATGACGAGATAGTTGTAACTTATAGT
CCAACTACTTATTTAAAAGGATAGTTATTC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50366)
Chromosome
6
Position
41.00 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48300)
Chromosome
6
Position
69.51 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42435)
Chromosome
6
Position
95.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39981)
Chromosome
6
Position
64.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8741)
Chromosome
6
Position
103.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8740)
Chromosome
6
Position
60.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG292 was used as an overgo probe on plate 4 [well G3]

Plausible BAC Matches:   P036J15,   P243F02

 Overgo Sequences

A sequence
TCGCTATATCTGTGCGCATCTGGT
B sequence
CAGAAGGGAACATGTCACCAGATG
AB sequence
TCGCTATATCTGTGCGCATCTGGTGACATG
Marker sequence
GTCAATTCAGCCTATGCACCATGAACCATCAGAATTAGCCAAAAAGTGAC
TTTTCCCCCCTTTATTTAGAAGGTAACATTTTTATGTATTGACTAAATCA
GTACATAGGTTGGACACAAAACCATATTTACAATCATAGGAAAAAGCCAA
GAAACCTGATGCAAAATCCTAACCAGAGCCTAGGATGTCTATGATAGAAT
CAGTGTCTTCTCGCTATATCTGTGCGCATCTGGTGACATGTTCCCTTCTG
ATTATTGCAATCCTTATTGAAACTCTTTTTTAGTTGAAATTTATGTTTAC
AATAGACAAGAAGTTCAAAATATCACAAAATTTTTGTTGGGCCTTATTTA
TGCTGAAAAAAGTTGCAAAGCGGATTTTGTATGTTTTTATGTTGATAAAT
ATTCAGTTTTAATTATATAGGGCTCATGACAAAGTTATATTTCATGATCT
TATGTTCCTCTGGATCTGAAGAGGAAGAATGTATTAGACGTCAGAGGGAA
CTTATGTTTTG
Genomic location of TG292  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D256 marker 256
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)