SGN Marker solcap_snp_sl_67905

SGN-M25653

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74218)
Chromosome
7
Position
30.41 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69815)
Chromosome
7
Position
15.91 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66142)
Chromosome
7
Position
20.48 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61984)
Chromosome
7
Position
4.12 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTCCAGTTTTGTCAAAAGCCATGATTTTTATTTTAGCAAGAGTCTCAAG
  
3' flanking region
TACTCTGCTCCTTTGAACAGAAGCCCTGATGTTGCTGCCTTTGAAAGTGC
SNP nucleotide
AG
SNPdb format
GTTCCAGTTTTGTCAAAAGCCATGATTTTTATTTTAGCAAGAGTCTCAAG[A/G]
TACTCTGCTCCTTTGAACAGAAGCCCTGATGTTGCTGCCTTTGAAAGTGC
  
Genomic location of solcap_snp_sl_67905  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25653 marker 25653
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)