SGN Marker solcap_snp_sl_68090

SGN-M25663

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69820)
Chromosome
7
Position
3.18 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66147)
Chromosome
7
Position
4.73 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61994)
Chromosome
7
Position
2.85 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTAGTATTATGTGCTAGATTTTAGTCACTTGAGTGTTTGTATAACTTTTT
  
3' flanking region
TACATATGAGTTTGTATCATTATAGGACATGGCCATTGTATACTTTGAAA
SNP nucleotide
TC
SNPdb format
TTAGTATTATGTGCTAGATTTTAGTCACTTGAGTGTTTGTATAACTTTTT[T/C]
TACATATGAGTTTGTATCATTATAGGACATGGCCATTGTATACTTTGAAA
  
Genomic location of solcap_snp_sl_68090  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25663 marker 25663
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)