SGN Marker solcap_snp_sl_68261

SGN-M25671

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74232)
Chromosome
7
Position
16.88 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62002)
Chromosome
7
Position
2.09 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATCAACAAAACCAAGAAGCTACTTGCCAAGAACTTGAGCAAGCTCAGTAT
  
3' flanking region
CACAGAGTTTCGACTCGTCTAGCTCTCTCCGAGCTCAAACCTTATCGAAC
SNP nucleotide
AC
SNPdb format
ATCAACAAAACCAAGAAGCTACTTGCCAAGAACTTGAGCAAGCTCAGTAT[A/C]
CACAGAGTTTCGACTCGTCTAGCTCTCTCCGAGCTCAAACCTTATCGAAC
  
Genomic location of solcap_snp_sl_68261  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25671 marker 25671
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)