SGN Marker solcap_snp_sl_68283

SGN-M25672

Synonyms  
SGN-U577663_snp786
SGN-U577663_snp786_solcap_snp_sl_68283
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70438)
Chromosome
7
Position
14.40 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66963)
Chromosome
7
Position
0.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63440)
Chromosome
7
Position
2.02 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62003)
Chromosome
7
Position
1.92 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGATCAAAGAAGTTTAATTGGGCAAAAATGATTTGGAAATCTCAAGAACA
  
3' flanking region
GATGAATGTTCAATTTGCTTGGATCAATTCAAGATTAGTGATAACTTAAT
SNP nucleotide
AG
SNPdb format
GGATCAAAGAAGTTTAATTGGGCAAAAATGATTTGGAAATCTCAAGAACA[A/G]
GATGAATGTTCAATTTGCTTGGATCAATTCAAGATTAGTGATAACTTAAT
  
Genomic location of solcap_snp_sl_68283  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25672 marker 25672
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)