Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker solcap_snp_sl_68409

SGN-M25677

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74236)
Chromosome
7
Position
9.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62008)
Chromosome
7
Position
1.45 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCGTTCCAAATAGACTAGTTATGTTATAAGTACAACTGTAGACTCGTAAT
  
3' flanking region
TTTTTCGTATGATAAATTTTTAAAATAATTTTTAAAAAATTTGGATCTTT
SNP nucleotide
TG
SNPdb format
TCGTTCCAAATAGACTAGTTATGTTATAAGTACAACTGTAGACTCGTAAT[T/G]
TTTTTCGTATGATAAATTTTTAAAATAATTTTTAAAAAATTTGGATCTTT
  
Genomic location of solcap_snp_sl_68409  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25677 marker 25677
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)