SGN Marker solcap_snp_sl_6873

SGN-M25698

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74247)
Chromosome
11
Position
49.52 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62029)
Chromosome
11
Position
8.42 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCTCCTCTGTTTTCTACGTTTCAACTTTCAAAAACACCTCTTTCTCTCTG
  
3' flanking region
GTAATTACAAAAACAAATTAAATCAATTCTTTTTCTTGAAGACAAAGTAA
SNP nucleotide
AT
SNPdb format
CCTCCTCTGTTTTCTACGTTTCAACTTTCAAAAACACCTCTTTCTCTCTG[A/T]
GTAATTACAAAAACAAATTAAATCAATTCTTTTTCTTGAAGACAAAGTAA
  
Genomic location of solcap_snp_sl_6873  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25698 marker 25698
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)