SGN Marker TG4

SGN-M257

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
600
Vector
pUC
Cutting Site
EcoR1/HindIII
Drug Resistance
AMP
Image
TG4 image not available
Forward sequence
TATTGGATTCTTGGAGCTTCCAGAGGAGTTGCTGAGATCAAATCTCTTTGTGCATGAATGCAACTCTTCATCAATGTCATGACTGGGTAT
GCTGGGACTTGAGTGACGGTCTCTTTTAACACAATTATCATCAAAACAAGTGGAAGAACCGACATTGGCAGAATGAGAGCTCATCTTACT
TTGTTTTTCCTCGGATAGGTTCACTCCTCTAGGAGATCTTCGAACCTTAACAGATTCTCCGTTAGTAGAATGAATGCTATTCAACTCCAC
AGACTTCAGAGATATCGTCACATTCTCACACATTCTAGACTTATCTCTTGTTCCACATGCAACTGCAGGTGAAACATTTTCTACAGGCTG
AGAATTTGCACCCTTACTGCCTTCCATAACCTTTTCAGGGAACCAAATATCATCTGGGTTGAGGGGTAAAGAAGCAGGATCAAGTTCAAA
GGATCCCGCATGTACACCATCTCGTTCAGTTCCAGTCATTTTGAAAGAAG
Reverse sequence
CCTTTTTCTCGGGAAAAGTTATTGGATTCTTGGAGCTTCCAGAGGAGTTGCTGAGATCAAATCTCTTTGTGCATGAATGCAACTCTTCAT
CAATGTCATGACTGGGTATGCTGGGACTTGAGTGACGGTCTCTTTTAACACAATTATCATCAAAACAAGTGGAAGAACCGTCATTGGCAG
AATGAGAGCTCATCTTACTTTGTTTTTCCTCGGATAGGTTCACTCCTCTAGGAGATCTTCGAACCTTAGCAGATTCTCCATTAGTAGTAT
GAATGCTATTCAACTCCACAGACTTCAGAGATATCGTCACATTCTCAGACATTCTAGACTTATCTCTTGTTCCAGATGCAACTGCAGGTG
AAACATTTTCTACAGGTTGAGAATTTGCACCCTTACTGCCTTCCATAACCTTTTCAGGGTACCAAATATCATCTGGGTTGAGGGGTAAAG
AAGCAGGATCAAGTTCAAAGGATCCCGCATGTACACCATCTCGTTCAGTTCCAGTCATTTTGAAAGAAG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1533163.7e-0857 (11.4% of RFLP seq)+
SGN-U1533161.6e-1386 (17.2% of RFLP seq)+
SGN-U1585154.2e-20101 (20.2% of RFLP seq)+
SGN-U1533163.5e-42170 (34.0% of RFLP seq)+
SGN-U1631132e-127265 (53.0% of RFLP seq)+
SGN-U1533163.8e-0857 (11.0% of RFLP seq)-
SGN-U1533166.6e-1686 (16.6% of RFLP seq)-
SGN-U1585151.8e-22101 (19.5% of RFLP seq)-
SGN-U1533166.2e-47170 (32.8% of RFLP seq)-
SGN-U1631138e-142265 (51.1% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8744)
Chromosome
1
Position
81.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG4 was used as an overgo probe on plate 15 [well A2]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P318P15,   P269I17,   P012M14,   P270N12,   P005O16,   P136D09

 Overgo Sequences

A sequence
AAAGGATCCCGCATGTACACCATC
B sequence
GACTGGAACTGAACGAGATGGTGT
AB sequence
AAAGGATCCCGCATGTACACCATCTCGTTC
Marker sequence
TATTGGATTCTTGGAGCTTCCAGAGGAGTTGCTGAGATCAAATCTCTTTG
TGCATGAATGCAACTCTTCATCAATGTCATGACTGGGTATGCTGGGACTT
GAGTGACGGTCTCTTTTAACACAATTATCATCAAAACAAGTGGAAGAACC
GACATTGGCAGAATGAGAGCTCATCTTACTTTGTTTTTCCTCGGATAGGT
TCACTCCTCTAGGAGATCTTCGAACCTTAACAGATTCTCCGTTAGTAGAA
TGAATGCTATTCAACTCCACAGACTTCAGAGATATCGTCACATTCTCACA
CATTCTAGACTTATCTCTTGTTCCACATGCAACTGCAGGTGAAACATTTT
CTACAGGCTGAGAATTTGCACCCTTACTGCCTTCCATAACCTTTTCAGGG
AACCAAATATCATCTGGGTTGAGGGGTAAAGAAGCAGGATCAAGTTCAAA
GGATCCCGCATGTACACCATCTCGTTCAGTTCCAGTCATTTTGAAAGAAG
Genomic location of TG4  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D257 marker 257
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)