SGN Marker solcap_snp_sl_6882

SGN-M25709

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74255)
Chromosome
11
Position
49.52 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69839)
Chromosome
11
Position
50.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66166)
Chromosome
11
Position
47.97 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62040)
Chromosome
11
Position
8.41 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGAAGAAAGAAGTCCTAAAATAATGTCAACTCCACCTCCCTCAAGTGTTG
  
3' flanking region
CTTCCAATATCCATCTTTATCACCACAGAGATTTCTCAAGGCCCCTGTGA
SNP nucleotide
AC
SNPdb format
AGAAGAAAGAAGTCCTAAAATAATGTCAACTCCACCTCCCTCAAGTGTTG[A/C]
CTTCCAATATCCATCTTTATCACCACAGAGATTTCTCAAGGCCCCTGTGA
  
Genomic location of solcap_snp_sl_6882  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25709 marker 25709
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)