SGN Marker solcap_snp_sl_68935

SGN-M25726

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74264)
Chromosome
6
Position
15.38 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69846)
Chromosome
6
Position
26.07 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66172)
Chromosome
6
Position
32.53 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62057)
Chromosome
6
Position
33.21 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTGGGAAGTGCAAAACAGAAGAAAGAGCAGTTTTTGTTTTGAAGGGGTT
  
3' flanking region
AAAAAAATGAAACTCTTATTCCTATATGTTGTGCAGGCTTTTAGAAACCA
SNP nucleotide
AG
SNPdb format
ATTGGGAAGTGCAAAACAGAAGAAAGAGCAGTTTTTGTTTTGAAGGGGTT[A/G]
AAAAAAATGAAACTCTTATTCCTATATGTTGTGCAGGCTTTTAGAAACCA
  
Genomic location of solcap_snp_sl_68935  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25726 marker 25726
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)