SGN Marker solcap_snp_sl_69075

SGN-M25750

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74280)
Chromosome
5
Position
2.19 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69858)
Chromosome
5
Position
2.20 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66182)
Chromosome
5
Position
4.08 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62081)
Chromosome
5
Position
0.71 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCTGATTTGTTGATTTACGACATATTGCAGCAATGGGCTGAAGATGTGGC
  
3' flanking region
ACTGAACTAAACATTCCAGCAGTTAAGCTTTTGACTTCGGGTGTTGCTGT
SNP nucleotide
TG
SNPdb format
CCTGATTTGTTGATTTACGACATATTGCAGCAATGGGCTGAAGATGTGGC[T/G]
ACTGAACTAAACATTCCAGCAGTTAAGCTTTTGACTTCGGGTGTTGCTGT
  
Genomic location of solcap_snp_sl_69075  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25750 marker 25750
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)