SGN Marker solcap_snp_sl_6926

SGN-M25767

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66190)
Chromosome
12
Position
60.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62098)
Chromosome
12
Position
14.64 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCGTCGAGGAATTCGCCGGCCTGTTTTTGGGAAGAAACAAAGATCGTCGA
  
3' flanking region
GAATTCGCCGGAGAAAGCTATCGCCAAGTTTACGGCTGCGACAGGAGTGT
SNP nucleotide
TG
SNPdb format
TCGTCGAGGAATTCGCCGGCCTGTTTTTGGGAAGAAACAAAGATCGTCGA[T/G]
GAATTCGCCGGAGAAAGCTATCGCCAAGTTTACGGCTGCGACAGGAGTGT
  
Genomic location of solcap_snp_sl_6926  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25767 marker 25767
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)