SGN Marker solcap_snp_sl_69312

SGN-M25778

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74297)
Chromosome
8
Position
27.66 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69871)
Chromosome
8
Position
17.36 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62109)
Chromosome
8
Position
6.89 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGTTGTCATCGAAACTCCACTAACTACATCTTTCCTTCTCCGCCGGTAA
  
3' flanking region
CATGCAAGCTATCCAATCTTCATCTCTCCGGCCATCTCCGGTCGACCCAT
SNP nucleotide
TC
SNPdb format
TTGTTGTCATCGAAACTCCACTAACTACATCTTTCCTTCTCCGCCGGTAA[T/C]
CATGCAAGCTATCCAATCTTCATCTCTCCGGCCATCTCCGGTCGACCCAT
  
Genomic location of solcap_snp_sl_69312  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25778 marker 25778
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)