SGN Marker solcap_snp_sl_69503

SGN-M25803

Synonyms  
SGN-U575172_snp764
SGN-U575172_snp764_solcap_snp_sl_69503
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70421)
Chromosome
9
Position
56.33 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62134)
Chromosome
9
Position
64.94 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAGCATCGCGCTCCAAACAACTTTCAGTAAACACACCATCATATTTATAA
  
3' flanking region
GTCATAATCTAGGAGAATTTCTTTCGAAGATCATTAATCACCTTCTTATC
SNP nucleotide
TC
SNPdb format
GAGCATCGCGCTCCAAACAACTTTCAGTAAACACACCATCATATTTATAA[T/C]
GTCATAATCTAGGAGAATTTCTTTCGAAGATCATTAATCACCTTCTTATC
  
Genomic location of solcap_snp_sl_69503  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25803 marker 25803
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)