SGN Marker solcap_snp_sl_69737

SGN-M25815

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74317)
Chromosome
9
Position
65.78 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69882)
Chromosome
9
Position
79.80 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66208)
Chromosome
9
Position
119.91 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62146)
Chromosome
9
Position
66.08 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTTACATCTAGTTCCATGGCCTCTCCGTTTTCATTTTCTTCTTTTGGGG
  
3' flanking region
TTTTGGGAAAGGTATCATATGTACAACAAGATGTACAGCAGCTGGCTGTA
SNP nucleotide
TG
SNPdb format
GTTTACATCTAGTTCCATGGCCTCTCCGTTTTCATTTTCTTCTTTTGGGG[T/G]
TTTTGGGAAAGGTATCATATGTACAACAAGATGTACAGCAGCTGGCTGTA
  
Genomic location of solcap_snp_sl_69737  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25815 marker 25815
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)