SGN Marker solcap_snp_sl_69787

SGN-M25817

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69883)
Chromosome
9
Position
81.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66209)
Chromosome
9
Position
138.67 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62148)
Chromosome
9
Position
66.29 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGATCTTTAGTTTTCCGCGAAATGAGGGGAGATATGAGAATAAGGTGAAG
  
3' flanking region
TTTATAGCTTGAAGTATGATTCTTGGAAAATGGGTGAGGCGTTTGATAGT
SNP nucleotide
AG
SNPdb format
AGATCTTTAGTTTTCCGCGAAATGAGGGGAGATATGAGAATAAGGTGAAG[A/G]
TTTATAGCTTGAAGTATGATTCTTGGAAAATGGGTGAGGCGTTTGATAGT
  
Genomic location of solcap_snp_sl_69787  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25817 marker 25817
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)