SGN Marker solcap_snp_sl_69861

SGN-M25820

Synonyms  
SGN-U580771_snp624
SGN-U580771_snp624_solcap_snp_sl_69861
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62151)
Chromosome
9
Position
66.61 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTATTCCCCTAGTAAAACCACCCAAGCCCTTAACAACTTCACCTTTGAG
  
3' flanking region
TGTGTTTCAACTCATCTCAAAATTACTCACATTAAAGCAACTCCAATTGA
SNP nucleotide
AG
SNPdb format
TCTATTCCCCTAGTAAAACCACCCAAGCCCTTAACAACTTCACCTTTGAG[A/G]
TGTGTTTCAACTCATCTCAAAATTACTCACATTAAAGCAACTCCAATTGA
  
Genomic location of solcap_snp_sl_69861  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25820 marker 25820
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)