SGN Marker solcap_snp_sl_69987

SGN-M25828

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74323)
Chromosome
7
Position
33.15 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62159)
Chromosome
7
Position
10.41 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCCCCATTTTAGAGTTGGTTGCATTTTACGACATAAATTAAGAGGTCTC
  
3' flanking region
TAGTATCAGCAACTGAAACCGATGTAGCAGTGGAAGAAGTAGAAGCAACT
SNP nucleotide
AG
SNPdb format
TTCCCCATTTTAGAGTTGGTTGCATTTTACGACATAAATTAAGAGGTCTC[A/G]
TAGTATCAGCAACTGAAACCGATGTAGCAGTGGAAGAAGTAGAAGCAACT
  
Genomic location of solcap_snp_sl_69987  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25828 marker 25828
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)