SGN Marker solcap_snp_sl_70013

SGN-M25836

Synonyms  
2325_3_350
2325_3_363_b
2325_3_363_b_2325_3_350_solcap_snp_sl_70013
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66380)
Chromosome
1
Position
46.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 62876)
Chromosome
1
Position
72.14 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62167)
Chromosome
1
Position
70.26 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTATATGTAACGCGAGTTTAGAAGGGATTTTAGCTGGGGCCGCTTCGCT
  
3' flanking region
GCCTACATTGCGTCAAAGCACGCAGTGGTAGGCATTATAAAAGCGGCCGC
SNP nucleotide
TC
SNPdb format
ATTATATGTAACGCGAGTTTAGAAGGGATTTTAGCTGGGGCCGCTTCGCT[T/C]
GCCTACATTGCGTCAAAGCACGCAGTGGTAGGCATTATAAAAGCGGCCGC
  
Genomic location of solcap_snp_sl_70013  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25836 marker 25836
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)