SGN Marker solcap_snp_sl_70117

SGN-M25852

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62183)
Chromosome
7
Position
49.52 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTGGAGTTTTAGTCTCTGTAGAGAATGTAACAACCCTGTCTGGTCTTCG
  
3' flanking region
ACTTGTGTTGTTGTTTTTGGCAATGTATTGATGGATCTTGACTCTGTTTC
SNP nucleotide
AG
SNPdb format
TTTGGAGTTTTAGTCTCTGTAGAGAATGTAACAACCCTGTCTGGTCTTCG[A/G]
ACTTGTGTTGTTGTTTTTGGCAATGTATTGATGGATCTTGACTCTGTTTC
  
Genomic location of solcap_snp_sl_70117  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25852 marker 25852
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)