SGN Marker solcap_snp_sl_70232

SGN-M25865

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62196)
Chromosome
8
Position
62.77 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TACTTCTCCGACTTCAAATCCTTCTCTGCGTGTTGGATTAGTCTCCTTAG
  
3' flanking region
TCACAAAGCAGGCAAACTACGGCTGGAGTATCAAGATGAAGAAGGGTTAT
SNP nucleotide
AG
SNPdb format
TACTTCTCCGACTTCAAATCCTTCTCTGCGTGTTGGATTAGTCTCCTTAG[A/G]
TCACAAAGCAGGCAAACTACGGCTGGAGTATCAAGATGAAGAAGGGTTAT
  
Genomic location of solcap_snp_sl_70232  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25865 marker 25865
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)