SGN Marker solcap_snp_sl_70252

SGN-M25869

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74349)
Chromosome
8
Position
77.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69900)
Chromosome
8
Position
76.87 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66223)
Chromosome
8
Position
119.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62200)
Chromosome
8
Position
62.65 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTCATTCCTAATGGTAGTTGCGTATTCTCACCCACAACAAGTCAAGGGT
  
3' flanking region
TGTATATCTGTTGCATCTTCTGATCTGTTATTGTGAATTGCGTAGCAAAA
SNP nucleotide
AG
SNPdb format
AGTCATTCCTAATGGTAGTTGCGTATTCTCACCCACAACAAGTCAAGGGT[A/G]
TGTATATCTGTTGCATCTTCTGATCTGTTATTGTGAATTGCGTAGCAAAA
  
Genomic location of solcap_snp_sl_70252  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25869 marker 25869
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)