SGN Marker solcap_snp_sl_70327

SGN-M25889

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74361)
Chromosome
1
Position
40.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62220)
Chromosome
1
Position
52.73 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGGATGAGCATTCAGACCTTGATACAATTGATTTGGCTACTGTGTCTAC
  
3' flanking region
TTAGCTGGTTATGGATATGGACTTCCAATAAGTCGTTTATATGCTCGCTA
SNP nucleotide
AG
SNPdb format
TTGGATGAGCATTCAGACCTTGATACAATTGATTTGGCTACTGTGTCTAC[A/G]
TTAGCTGGTTATGGATATGGACTTCCAATAAGTCGTTTATATGCTCGCTA
  
Genomic location of solcap_snp_sl_70327  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25889 marker 25889
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)