SGN Marker TG367

SGN-M259

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG367 image not available
Forward sequence
CTGCGCTTTCAGTGAAAACTATACGCATCAGTTCTGCTATTTTGGCCGCACAGAGTCCATTCTTTTACAAGGCTAGGAGTTTTTAATGCT
CTGTTTTTGATGAATTAGAAAGTCTTGATTGCTTGTTTTTTGACGTCTTCTTGTTTTCTTCATAGCTATTCTCCAATGGCATGAGAGAGT
CAGAGTCAGAGAAGCAGCTTGTTACTGTACAAATCTATGCCTCGGGTTAGTATTAAGATTTTTTAGTTGTAGTTTGGCATGTTCTCATTT
CATTGTATTGTCCTTTCCGTTACTCCTATTACACAGACTAGCCACCTCTTGTGCACTTGATTTGACATTTCAATAACAAGTTTTAGATGT
TTAGGATGTGCAATTAGAGAGCAATGTGTATCAATCACTAATTGAAAATTCAGTTTTTTCGGCTGTTTGAATTCATAGAATTAAGGGGAT
TCTTGTACTTCCATCAGATGGATGTTTAAGAAAGAAGTATTTTTGACCAATAAGTT
Reverse sequence
CTCACTATAGGGAGACAGCTTGCATGCCTGCAGTGTCTCATGCATGATGCAACCTCAAATTTGTCAGCAGCCATAAGCACATCAAGCATA
GCAGTAGCTGGTATCGTAGACAAAGTATTGCTATACATGAATTGTAGTAACTTTACGAAGGCAGCTTCTTCTGCGAGAAAAAGAGATAAA
GAAAGGTGGATGAGAAAAAAAGAAAATTTGTGAACACAAATTAAAGGAACTATATGTTCACTAGTTAAAGTAACTATCTAAGAACTCTTC
TTTAAATATGCTTAGAAGCAAAACGAGCAGTACTAGCACTTGGAACATGTTATTAACCTTGCAAACATATGAATAGACAATCAATGTTTC
ACACAAATGTTTCGGAAAGAGACACAATTTTTGTTCTGGTGTCTAATCCTTCTATTATTCATCAAGATAGATAAAGTACTGGATATTTAG
AATGATGCTTTTCTATATTTGAAGACTTCTTATTACTTCTTAACATTTCTACTTAGCCATGTGAACACGAGGTCATGAGTTCAAGCTATG
AAAACAGCCTCTTGCAAAAATATAGGGTA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1612261.1e-1151 (9.0% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53891)
Chromosome
12
Position
50.10 cM
Confidence
uncalculated
Protocol
RFLP

Pentanal_content_pna12_1 Fruit_weight_fw12_1 Titratable_acidity_ta12_1 Fruit_diameter_fd12_1 pH_pH12_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53287)
Chromosome
12
Position
46.04 cM
Confidence
uncalculated
Protocol
unknown

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50379)
Chromosome
12
Position
47.45 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48313)
Chromosome
12
Position
66.19 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40015)
Chromosome
12
Position
68.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8747)
Chromosome
12
Position
47.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8746)
Chromosome
12
Position
43.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG367 was used as an overgo probe on plate 16 [well F12]

Plausible BAC Matches:   P302G23,   P116P08,   P300M01

 Overgo Sequences

A sequence
CGCATCAGTTCTGCTATTTTGGCC
B sequence
AGAATGGACTCTGTGCGGCCAAAA
AB sequence
CGCATCAGTTCTGCTATTTTGGCCGCACAG
Marker sequence
CTGCGCTTTCAGTGAAAACTATACGCATCAGTTCTGCTATTTTGGCCGCA
CAGAGTCCATTCTTTTACAAGGCTAGGAGTTTTTAATGCTCTGTTTTTGA
TGAATTAGAAAGTCTTGATTGCTTGTTTTTTGACGTCTTCTTGTTTTCTT
CATAGCTATTCTCCAATGGCATGAGAGAGTCAGAGTCAGAGAAGCAGCTT
GTTACTGTACAAATCTATGCCTCGGGTTAGTATTAAGATTTTTTAGTTGT
AGTTTGGCATGTTCTCATTTCATTGTATTGTCCTTTCCGTTACTCCTATT
ACACAGACTAGCCACCTCTTGTGCACTTGATTTGACATTTCAATAACAAG
TTTTAGATGTTTAGGATGTGCAATTAGAGAGCAATGTGTATCAATCACTA
ATTGAAAATTCAGTTTTTTCGGCTGTTTGAATTCATAGAATTAAGGGGAT
TCTTGTACTTCCATCAGATGGATGTTTAAGAAAGAAGTATTTTTGACCAA
TAAGTT
Genomic location of TG367  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D259 marker 259
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)