SGN Marker solcap_snp_sl_70564

SGN-M25914

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74376)
Chromosome
7
Position
81.86 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69917)
Chromosome
7
Position
70.32 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66241)
Chromosome
7
Position
100.58 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62245)
Chromosome
7
Position
64.58 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTAGAAACCATCAAATCTTTTAACTCCCAAAGGCCAAAAGGGTTGATACA
  
3' flanking region
AGCAGCAAATTCTCAGAGATAAGCAAAAGTGGTTGACCAAAAATCTTCAA
SNP nucleotide
AC
SNPdb format
CTAGAAACCATCAAATCTTTTAACTCCCAAAGGCCAAAAGGGTTGATACA[A/C]
AGCAGCAAATTCTCAGAGATAAGCAAAAGTGGTTGACCAAAAATCTTCAA
  
Genomic location of solcap_snp_sl_70564  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25914 marker 25914
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)