SGN Marker solcap_snp_sl_70807

SGN-M25928

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74388)
Chromosome
7
Position
76.32 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62259)
Chromosome
7
Position
63.66 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAGTTTCAGCTTCATCACCAATGTAAATGTATATACGTATATAAACTTAT
  
3' flanking region
AACCCCTAAACAGAACTTATTGACAACTTAGTAGTAACGAATGAGCCATG
SNP nucleotide
AG
SNPdb format
CAGTTTCAGCTTCATCACCAATGTAAATGTATATACGTATATAAACTTAT[A/G]
AACCCCTAAACAGAACTTATTGACAACTTAGTAGTAACGAATGAGCCATG
  
Genomic location of solcap_snp_sl_70807  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25928 marker 25928
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)