Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker solcap_snp_sl_70973

SGN-M25937

Synonyms  
CL017397-0332
CL017397-0332_solcap_snp_sl_70973
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62268)
Chromosome
7
Position
62.92 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GATGATGCTGGGTGCTTTGGATCTAGAAAGAGATTTAAGCCAGGCCTTTC
  
3' flanking region
ATACACACAGCTGAGGAATACAATGGCAATCCAGATGAGTCTGAGAAACA
SNP nucleotide
TG
SNPdb format
GATGATGCTGGGTGCTTTGGATCTAGAAAGAGATTTAAGCCAGGCCTTTC[T/G]
ATACACACAGCTGAGGAATACAATGGCAATCCAGATGAGTCTGAGAAACA
  
Genomic location of solcap_snp_sl_70973  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25937 marker 25937
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)