Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_710

SGN-M25940

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74394)
Chromosome
11
Position
50.61 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62271)
Chromosome
11
Position
10.68 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTATTTTCGAAATGGAGGCACTAGGTACATTAGATATTTCGATAAACCA
  
3' flanking region
ATGTCAGGGAATTTCCCAAAGTCGATAAACAAGCTGCGAAATCTCTTCAA
SNP nucleotide
TG
SNPdb format
TCTATTTTCGAAATGGAGGCACTAGGTACATTAGATATTTCGATAAACCA[T/G]
ATGTCAGGGAATTTCCCAAAGTCGATAAACAAGCTGCGAAATCTCTTCAA
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_710  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25940 marker 25940
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)