SGN Marker solcap_snp_sl_71142

SGN-M25960

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74407)
Chromosome
7
Position
67.53 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69933)
Chromosome
7
Position
51.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66257)
Chromosome
7
Position
68.32 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62291)
Chromosome
7
Position
62.08 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATAAGTCAGAAAAACCTATTTCATTGACTAATGTTTTTGAAGTGGTTGC
  
3' flanking region
GATGACCTACTTACGTTAAACAAGAACTTGCATAATGTGAGTAATCTGTT
SNP nucleotide
TG
SNPdb format
AATAAGTCAGAAAAACCTATTTCATTGACTAATGTTTTTGAAGTGGTTGC[T/G]
GATGACCTACTTACGTTAAACAAGAACTTGCATAATGTGAGTAATCTGTT
  
Genomic location of solcap_snp_sl_71142  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25960 marker 25960
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)