SGN Marker solcap_snp_sl_73

SGN-M25970

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69937)
Chromosome
5
Position
61.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62301)
Chromosome
5
Position
60.38 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTCATGGTCATAAGAACTTTTCTCTCTAATTCTCATTTCATTTGGAAGCT
  
3' flanking region
CTCCTTTCCAGATTTTTCCTGCCTTGTATCGACAGTCAATGTACTTGCAT
SNP nucleotide
TC
SNPdb format
CTCATGGTCATAAGAACTTTTCTCTCTAATTCTCATTTCATTTGGAAGCT[T/C]
CTCCTTTCCAGATTTTTCCTGCCTTGTATCGACAGTCAATGTACTTGCAT
  
Genomic location of solcap_snp_sl_73  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25970 marker 25970
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)