SGN Marker solcap_snp_sl_7326

SGN-M25976

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74415)
Chromosome
8
Position
5.83 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69939)
Chromosome
8
Position
0.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62307)
Chromosome
8
Position
0.99 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGATCGGCTTTTGACCGTACTTTCTCCATGAGTATTCATCTGCCGGAATA
  
3' flanking region
CAGCAGTTTTTGAACTGATCGCCGGAACTCTGATCACTTTTTTTACTCGA
SNP nucleotide
TC
SNPdb format
TGATCGGCTTTTGACCGTACTTTCTCCATGAGTATTCATCTGCCGGAATA[T/C]
CAGCAGTTTTTGAACTGATCGCCGGAACTCTGATCACTTTTTTTACTCGA
  
Genomic location of solcap_snp_sl_7326  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25976 marker 25976
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)