SGN Marker solcap_snp_sl_7387

SGN-M25983

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74419)
Chromosome
8
Position
21.33 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69943)
Chromosome
8
Position
5.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62314)
Chromosome
8
Position
2.91 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAACCCTAAACTTCTTCAGAAATTGTAAGCATAATCGGAAGAATTTGGAG
  
3' flanking region
AGGAGAGATCAGAAATGGGCGATGTAGCTGATAAAGTTGCTTATTTTCAA
SNP nucleotide
TC
SNPdb format
AAACCCTAAACTTCTTCAGAAATTGTAAGCATAATCGGAAGAATTTGGAG[T/C]
AGGAGAGATCAGAAATGGGCGATGTAGCTGATAAAGTTGCTTATTTTCAA
  
Genomic location of solcap_snp_sl_7387  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25983 marker 25983
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)