SGN Marker TG34

SGN-M26

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2400
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
TG34 image not available
Forward sequence
CAAAATTGATTTGGGGTTCTGATCGGACATCGCCCTGCAAAAAAAAAACCCCAAAATCCAAATTCAGTAACGAAAGCATACCGAAGATGC
ACAAAAAAAGGAAATAAATTCGAGTGAGATGAAACGAAGAACCAAAAGCACAGCGCAGACAAAAGATGAAGGTACATAAAAAGTGAGAGA
GAAAATCTGTATTTACAGTGATGAGAAGCACCGTAATAAGCACGCTAAGTACTAAAATGTATTAATGACTTATTAAGTACGCTAAAGGTA
AAATCGTGTATTTAAACGCTCGGAGGAAACAAAATAACCTAAGAATATATAAAAATTATACATTTATGGTAACTATGTAAGTTAAAAAAA
TTTATTTCCATAATTATTTTTATATACGTGGTCGTTTTACATTTCATATTCATCAAGAAAACTAGATAAGTTTATCGTTATATATTTATT
TAGTGTTCTTTTTAAAGTCAAAATTTTTAATTACTGAAAATAAATTAAATTACGTTGACTAATTAAATTGACCAATGAACCAGAATTAAT
TATTTAGTTTCTTACATTATACGCTTATAACTCTTAAGGATAAAATAGAAAGCGTAATATTATTTAC
Reverse sequence
GCTGCAGGTAAATGAGTTCTCTATATTTCCTATTGTGTAGTTCTTTACATCTACAAACAAGTTGGCGTCAGCTGTATGAATCGTCACTTA
CGATATTACACCATTTAAACTCATCTCATGCCATTATTATGCAAATACAAATAAAAAACTTTTAAATTTAAATTCTCTATATTTTCTACA
CTTAAAAATCTCTGTAAGGTAATATTATGCAGTTTTACGTGCATACAAAAGAACCTCTCACCTACCTACCAATCTTCCAAGCACAAGCAA
TCATTTTTCAACTCTTCTTAGGTTGTTGATTTAAGACAACATTGCGAGTCACCACTAGTTGGTCATAAATGGAGTTGTGTTACTGCATGT
TTTTGTTCTTCCTGATCAAAATTTGCAAGGATAATGTTCTTGGTAATAAAGACATGCATGTATTCTTCATTCACAGGCGTAGGTTGTCCA
CTATCTTGGTGAGGCTGAAGTTTGCTGAACACATGAAGGAAGCAGTGACATACATAGAACAAGGTCATATTCGAGTTGGACCCGATACAG
TTGTTGACCCAGCATTTCTCGTGACGAGAAATATGGAGGATTTCATCACTTGGGTAGATACATCTAAGATTAGGAGAAAGGTCTTGGAGT
ACAACGATCAGCTAGACGATTATG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1470811.1e-0846 (7.6% of RFLP seq)+
SGN-U1594785e-116222 (33.9% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53275)
Chromosome
2
Position
95.14 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50373)
Chromosome
2
Position
45.73 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48307)
Chromosome
2
Position
123.15 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40002)
Chromosome
2
Position
111.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7791)
Chromosome
2
Position
95.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7792)
Chromosome
4
Position
98.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7796)
Chromosome
2
Position
41.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG34 was used as an overgo probe on plate 16 [well F11]

Plausible BAC Matches:   P028D10,   P046M08

 Overgo Sequences

A sequence
TCGAGTGAGATGAAACGAAGAACC
B sequence
TCTGCGCTGTGCTTTTGGTTCTTC
AB sequence
TCGAGTGAGATGAAACGAAGAACCAAAAGC
Marker sequence
CAAAATTGATTTGGGGTTCTGATCGGACATCGCCCTGCAAAAAAAAAACC
CCAAAATCCAAATTCAGTAACGAAAGCATACCGAAGATGCACAAAAAAAG
GAAATAAATTCGAGTGAGATGAAACGAAGAACCAAAAGCACAGCGCAGAC
AAAAGATGAAGGTACATAAAAAGTGAGAGAGAAAATCTGTATTTACAGTG
ATGAGAAGCACCGTAATAAGCACGCTAAGTACTAAAATGTATTAATGACT
TATTAAGTACGCTAAAGGTAAAATCGTGTATTTAAACGCTCGGAGGAAAC
AAAATAACCTAAGAATATATAAAAATTATACATTTATGGTAACTATGTAA
GTTAAAAAAATTTATTTCCATAATTATTTTTATATACGTGGTCGTTTTAC
ATTTCATATTCATCAAGAAAACTAGATAAGTTTATCGTTATATATTTATT
TAGTGTTCTTTTTAAAGTCAAAATTTTTAATTACTGAAAATAAATTAAAT
TACGTTGACTAATTAAATTGACCAATGAACCAGAATTAATTATTTAGTTT
CTTACATTATACGCTTATAACTCTTAAGGATAAAATAGAAAGCGTAATAT
TATTTAC
Genomic location of TG34  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26 marker 26
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)